DNA databanken: privacy in ruil voor veiligheid?

Gent - 3 mei 2007

Onderwerpen

DNA-databanken roepen heel wat maatschappelijke vragen op. Vandaag wordt in ons land een DNA-staal genomen van mensen die veroordeeld zijn tot een gevangenisstraf van minstens vijf jaar. In Groot-Brittannië gaat men een stap verder. Daar zitten miljoenen mensen in de database. Van iedereen die in contact is gekomen met het gerecht wordt een DNA-staal genomen. Argumenten voor het gebruik van DNA-databanken komen neer op de verhoogde pakkans van misdadigers van ernstige delicten. Tegenstanders vrezen echter dat er nog te weinig maatregelen zijn om de veiligheid van dergelijke databanken te garanderen. En misbruik van gegevens in een DNA-databank zet de deur open voor genetische discriminatie (door bijvoorbeeld werkgevers of verzekeringsmaatschappijen).

Is deze angst gefundeerd? Wat is DNA eigenlijk? Hoe gaat een DNA-identificatie in zijn werk, en is die echt zo betrouwbaar? Welke misbruiken zijn mogelijk? In het wetenschapscafé van 3 mei vind je antwoorden op je vragen, kan je je eigen mening kwijt en word je uitgenodigd voor een pittige cafédiscussie.

Als je meer wil lezen over DNA en DNA-databanken kan je naar de bibliotheek gaan of een beetje googlen op de computer, maar we geven je alvast graag volgende vliegende start:

Desoxyribonucleinezuur (ofte DNA)

Desoxyribonucleïnezuur of DNA (een afkorting van DesoxyriboNucleic Acid) is een macromolecule die in levende wezens de drager is van erfelijke informatie. Op het DNA liggen de afzonderlijke genen. Eén gen bevat over het algemeen de instructies voor het aanmaken van één bepaald soort eiwit. De eiwitten zijn uiteindelijk bepalend voor de biochemische activiteiten van de cel, en daarmee voor de eigenschappen van het organisme. Het aantal genen kan per organisme verschillen; de mens heeft ongeveer 25 000 genen. Bij normale celdeling wordt het DNA in de oorspronkelijke cel gekopieerd, en elke dochtercel krijgt een kopie van het totale genoom. Bij de celdeling waarbij de geslachtscellen ontstaan, krijgt elke dochtercel slechts de helft van het DNA in de moedercel. Omdat geslachtscellen als ze versmelten ook hun DNA samenvoegen, heeft het nieuwe organisme dat hieruit ontstaat, weer de normale hoeveelheid DNA. De eigenschappen van het nieuwe organisme, zoals vastgelegd in het DNA, zijn op deze wijze van beide ouders afkomstig.

Een DNA-molecuul bestaat uit twee lange ketens of strengen die precies als puzzelstukjes in elkaar passen. Elk van deze twee strengen draagt een enorm lange opeenvolging van basen. Er zijn vier basen mogelijk: Adenine (A), Thymine (T), Cytosine (C) of Guanine (G). De A in een streng past tegenover de T in de tegenoverliggende streng en de G past tegenover de C. Hoewel er dus maar vier verschillende 'codeletters' zijn is het aantal mogelijke lettercombinaties van een stukje DNA van slechts honderd van deze zogenaamde baseparen al astronomisch groot. De twee strengen die precies op elkaar passen vormen een dubbele helix, de vorm van een spiraal of wenteltrap.

DNA-dossier Kennislink
Een ideaal startpunt voor een ontdekkingstocht: het DNA-dossier van het Nederlandse Kennislink.

DNA volgens wikipedia
Grondig overzicht van wat DNA is.

Genetische vingerafdrukken

DNA als bewijsmateriaal
Heel toegankelijk artikel dat uitlegt hoe DNA als bewijsmateriaal kan dienen, en hoe betrouwbaar het is.

Create a DNA fingerprint
Op deze site kan je zelf een DNA-vingerafdruk maken en een misdaad oplossen. Verhelderend!

Genetic fingerprinting (volgens wikipedia)
Grondige uitleg, vooral over de verschillende methodes die gebruikt kunnen worden om een genetische vingerafdruk te maken, maar ook een overzicht van cases waar DNA een rol heeft gespeeld.

How DNA evidence works
De bekende site "howstuffworks" doet haar ding voor DNA-bewijs. Duidelijke stap-voor-stap uitleg in zes stappen.

Dossier DNA-onderzoek in strafzaken
Handig overzichtsdossier uit de bibliotheek van het federaal parlement over het gebruik van DNA als identificatiemiddel in strafzaken in België onze buurlanden. Handelt enkel over de wetgeving terzake.

DNA databanken

Jaarverslag FOD Justitie
Jaarverslag van de Federale Overheidsdienst Justitie met op pagina 80 de activiteiten van het Nationaal Instituut voor Criminalistiek en Criminologie die de DNA databank van België beheert.

An International DNA Database
Artikel van Allison Puri (Boston College International and Comparative Law Review). Voornamelijk met betrekking tot de situatie en wetgeving in Amerika maar er worden ook sociaal-maatschappelijke vragen gesteld die pertinent zijn voor DNA-databanken in het algemeen en de oprichting van een internationele DNA-databank meer specifiek.

Argumenten voor en tegen DNA-databanken
Korte context schets en dan een mooie oplijsting van pro's en contra's voor het aanleggen en gebruiken van DNA-databanken door het gerechtelijk apparaat.

Stellingen

Gasten

Criminoloog Prof. dr. Gert Vermeulen

Als doctor in de rechten, directeur van het Institute for International Research on Criminal Policy (IRCP), en adviseur voor de Europese Commissie over een Europese DNA-databank is Gert de expert bij uitstek om het café publiek uit te leggen wat bijvoorbeeld het Verdrag van Prüm is. Hij deelt graag zijn uitgebreide kennis omdat hij overtuigd is van het belang van wetenschapscommunicatie. Gert doceert aan de Universiteit Gent en de Universiteit van Trento/Milaan en is betrokken bij talrijke onderzoeksprojecten over (internationaal) straf(proces)recht en strafrechtelijk beleid. En het belangrijkste van al: Gert is van plan om er op 3 mei een gezellige boel van te maken. DNA-citaat: "AATGAAGGTACCCCGGATATACCGGGCGGGCCAAT".

Moraalfilosofe Dr. An Ravelingien

An Ravelingien is als doctor in de Wijsbegeerte verbonden aan de Universiteit Gent. Haar vakgebied is bio-ethiek en ze is geïnteresseerd in de mate waarin bepaalde biotechnologieën nieuwe ethische en sociale dilemma's opwerpen. Haar doctoraatsonderzoek focuste op ethische aspecten rond xenotransplantatie, de transplantatie van dierlijke cellen, -weefsels en -organen in mensen. Sinds 2007 is An werkzaam op een FWO-project dat handelt over ethische implicaties van de technologie van 'breinverbetering': behandelingen die bedoeld zijn om de gemoedstoestand en het denken van mensen ingrijpend te "verbeteren". An werkt mee aan dit wetenschapscafé omdat ze het een boeiend en zeer actueel onderwerp vindt, dat enerzijds ontzettend beloftevol is, en anderzijds belangrijke vragen opwerpt over onder meer de mate waarin we 'eigenaar' zijn van ons eigen lichamelijk materiaal. DNA-citaat: "ATGACCAGGGTATACCGTTTTTTTTAAGCGCGC".

Moleculair bioloog Dr. Friedel Nollet

Friedel is moleculair bioloog in een laboratoriumziekenhuis, en heeft momenteel veel om handen. Hij ontcijfert de foute DNA-codes die een kanker kunnen veroorzaken, en maakt daar gebruik van om kankercellen op te sporen en de patiënten te volgen wanneer die behandeld worden. Zijn specialiteit is vooral de diagnose en de opvolging van leukemieën en lymfeklierkankers, maar hij spoort ook een aantal erfelijke ziektes op en voert DNA-fingerprinting uit in het kader van medische vraagstellingen. Hij vindt het zijn opdracht om het publiek goed te informeren over de mogelijkheden en beperkingen van "de DNA-code" en de maatschappelijk consequenties daarvan. Friedel is er verder van overtuigd dat we binnenkort onze DNA-code razendsnel zullen kunnen bepalen, maar dat we niet zullen weten wat er mee te doen. "DNA-citaat: “AAACGTAGCCGATCGGGGGCATATATCGCGCG".

Bio-informaticus Dr. Pieter De Bleser

Pieter De Bleser is als expert bio-informaticus verbonden aan het Departement voor Moleculaire Biomedische Research - VIB (Universiteit Gent) en dagelijks aan het werk met wetenschappelijke DNA-databanken. Naast het ondersteunen van andere onderzoekers uit de “natte” laboratoria in hun bio-informaticanoden, tracht hij uit te zoeken hoe de regulatie van gentranscriptie in mekaar zit. Het doel is om antwoorden te vinden op vragen zoals waarom een mens verschilt van een chimpansee waarvan we genetisch, waar het chimp-genoom één nucleotide anders is dan de menselijke versie, slechts voor 1,23 % afwijken! Hij doet mee aan het wetenschapscafé omdat DNA-databanken niet alleen beloften maar ook maatschappelijke gevaren met zich meebrengen en omdat het noodzakelijk is dat alle, ook de negatieve, aspecten worden belicht in een open, vrije dialoog.

Knack-journalist & moderator Joël De Ceulaer

Joël de Ceulaer is redacteur van het tijdschrift Knack. In 2004 maakte hij de succesvolle tv-serie "Grote Vragen" voor Canvas, waarvan in 2005 het gelijknamige boek verscheen. Vanuit zijn brede interesse schreef hij tientallen stukken over wetenschap, religie en filosofie. Joël is een ervaren moderator, en enthousiast over het concept wetenschapscafé. Zo is hij op 24 april in het science café Tilburg (Nederland) aan het werk te zien. DNA-citaat: "Sorry, ik houd mijn DNA liever voor mezelf."

Inleider, professioneel Neveneffect Lieven Scheire

Lieven is het bewijs bij uitstek dat een passie voor wetenschap niet tot saaie of droge mensen hoeft te leiden. Nog tijdens zijn studies natuurkunde aan de Universiteit Gent, debuteerde hij als stand-up comedian en even later begon hij als mede-oprichter in de cabaret-groep Neveneffecten, ondertussen bekend van het gelijknamige tv-programma. Begin dit jaar kreeg Lieven een eigen rubriek in de "De laatste show", waarin hij iedere dinsdag op begrijpelijke en humoristische wijze zijn passie voor de fysica aan de kijkers probeert door te geven. De gedroomde inleider voor ons café dus. DNA-citaat: "VCCFFTECFTENVCEFCVVFTNEFFVETC".

Links


 



Vorige edities

Mis het volgende wetenschapscafé niet! Schrijf je in op onze nieuwsbrief:

Volg ons op facebook en twitter: